Where are the choroid plexuses found, and what is their function?

Where are the choroid plexuses found, and what is their function?

2 months ago

Solution 1

Guest Guest #4187
2 months ago
It is found in the ventricles of the brain. Its function is to "The choroid plexus serves two important functions in the body. It produces cerebrospinal fluid and helps to provide a barrier, which protects the brain and other central nervous system tissue from toxins."

📚 Related Questions

Question
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
Solution 1

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.






Question
How could UV light potentially affect an organism’s trait
Solution 1

UV light can affect the traits of organisms by changing their DNA sequence.

The DNA of organisms store the genetic information which is physically expressed as traits during gene expressions.

Also, the nucleotide sequence of DNA determines the kind of traits that will be expressed.

UV light has the capacity to alter the nucleotide sequence of DNAs, a phenomenon known as mutation.

When the DNA sequence is altered, the traits originally expressed by the DNA also become altered.

More on mutations can be found here: brainly.com/question/17106056?referrer=searchResults

Solution 2
UV light could change the DNA of the skin cells of the organism, possibly causing cancer cells to form.
Question
The cambium produces xylem toward the center of a tree and phloem toward the outside. do you think it would make any difference if the positions of the xylem and phloem were reversed? why?
Solution 1

The wood is xylem, and the bark is phloem. So, if you reverse the two, the tree is unlikely to be able to support its own weight.

What is are vascular tissues?

Vascular tissue is an intricate conducting tissue found in vascular plants that is made up of multiple cell types.

The xylem and phloem are the primary components of vascular tissue. From within, those same two tissues transport fluid as well as nutrients.

In plants, cambium is a layer of actively dividing cells that exists between xylem (wood) and phloem tissues and is responsible for the secondary growth of stems and roots.

A cambium is a tissue layer in plants that provides partially undifferentiated cells for plant growth.

It is found between the xylem and the phloem. A cambium is also a cellular plant tissue that grows phloem, xylem, or cork by division, resulting in secondary thickening.

The wood is called xylem, as well as the bark is called phloem. If the two are reversed, the tree is very unlikely to be able to endorse its own weight.

Thus, this can be the consequence of reversing the xylem and phloem.

For more details regarding vascular tissues, visit:

brainly.com/question/4522173

#SPJ2

Solution 2
Xylem is the wood and the phloem is the bark. so if you were to reverse the two the tree would likely not be able to hold up its own weight
Question
While breathing into a plastic bag what happens to the levels of carbon dioxide in your blood?
Solution 1
When you hold your breath the ongoing accumulation of carbon dioxide in your cells, in your blood and lungs will eventually irritate and trigger impulses from the respiratory center part of your brain. Rising levels of carbon dioxide signal the body to breathe and ensure our unconscious and autonomous respiration.
Question
Why are lipoproteins needed to transport lipids in the bloodstream? g?
Solution 1
Lipoproteins form water-soluble complexes for transport through the bloodstream by combining water-insoluble lipids with polar phospholipids and proteins.
Lipids are hydrophobic, therefore they are water-insoluble and they cannot be transferred in water solutions, such as blood. Lipoproteins are assemblies that create a hydrophilic compound which permits the lipids to flow in the bloodstream.

Question
Provide an example to illustrate how an adaptation may lead to natural selection. the example should be detailed enough to show that you understand the linkage.
Solution 1
So basically adaption could lead to natural selection by the enviromental changes. So for example: Fish species that live in dark/cave areas have vestigial, nonfunctioning eyes because when the ancestors ended up in the caves there was no longer any natural selection that mantained the function for the fishs eyes. 
Solution 2

Answer:

I have chosen to use peppered moths and black moths as my example of adaptation.

The species called peppered moths is widespread in Britain and Ireland. This type of moth got its name due to the grey- and black-speckled pattern it has. This structural trait provides the peppered moths with camouflage when resting on tree trunks. A genetic mutation caused some of the moths to have almost black wings. However, moths with this mutation had a smaller population, because these forms were not completely camouflaged when at rest and predators could spot them easily. Thus, the population of the pale peppered moths was higher than that of the black moths.

The nineteenth century brought with it a lot of industrialization. The industrialization created a tremendous amount of soot and air pollution. This led to blackening of urban tree trunks and walls. So, black moths had better camouflage on tree trunks than the peppered moths did. Due to this, there was an increase in the population of black moths, and a decrease in the population of peppered moths as birds more easily preyed upon them because they were easier to see on the dark tree trunks.

Thus, the species of moth that adapted to the changing environmental conditions were survived.

Question
Why is evolution so central to every aspect of biology g?
Solution 1
It is used to develop the tree of life and understand relationship between organisms. This study enables scientists comprehend the morphology and behaviour of organism. Its study is also significant in medicine in understanding the evolution of diseases and hence important in drug development.  
Question
A student conducted an experiment to test the effect of the digestive enzyme pepsin on cooked egg white and potato in the presence of hydrochloric acid at a pH of 1. Which could be a probable inference? Pepsin digests egg white because it mainly contains protein. Pepsin digests potato because it mainly contains starch. Pepsin digests egg white because it mainly contains fat. NextReset
Solution 1
This would be the answer:

Pepsin digests egg white because it mainly contains protein.

Hope this helps.
Question
What are the 3 types of volcanoes?
Solution 1
There are three main types of volcano - composite or strato, shield and dome.
Question
Mary had a baby last year. She is normally very healthy, but has been experiencing some embarrassing symptoms.
Solution 1
It is most likely because Mary’s body went through changes. And from 6 months to a year after pregnancy these “embarrassing symptoms can persist. There can be hormonal changes and cause the body to do abnormal things.

I hope this helps.
Solution 2

Answer:

Stress incontinence

Explanation: it's a condition of involuntary urination during coughing, sneezing, laughing, or other sudden movement. Strengthening these muscles by doing pelvic floor exercises can help prevent this condition.